Codex Sinaiticus or "Sinai Bible" is one of the four great uncial codices, handwritten copies of a Christian Bible in Greek. The codex is a historical treasure; the codex is an Alexandrian text-type manuscript written in uncial letters on parchment and dated paleographically to the mid-4th century. Scholarship considers the Codex Sinaiticus to be one of the most important Greek texts of the New Testament, along with the Codex Vaticanus; until Constantin von Tischendorf's discovery of the Sinaiticus text, the Codex Vaticanus was unrivaled. According to Kurt and Barbara Aland, Sinaiticus was highly overrated by Tischendorf, as it contains numerous singular readings and careless errors, "is distinctly inferior to B"; the Codex Sinaiticus came to the attention of scholars in the 19th century at Saint Catherine's Monastery in the Sinai Peninsula, with further material discovered in the 20th and 21st centuries. Although parts of the codex are scattered across four libraries around the world, most of the manuscript is held today in the British Library in London, where it is on public display.
Since its discovery, study of the Codex Sinaiticus has proven to be useful to scholars for critical studies of biblical text. While large portions of the Old Testament are missing, it is assumed that the codex contained the whole of both Testaments. About half of the Greek Old Testament survived, along with a complete New Testament, the entire Deuterocanonical books, the Epistle of Barnabas and portions of The Shepherd of Hermas; the codex consists of parchment in double sheets, which may have measured about 40 by 70 cm. The whole codex consists, with a few exceptions, of quires of eight leaves, a format popular throughout the Middle Ages; each line of the text has some twelve to fourteen Greek uncial letters, arranged in four columns with chosen line breaks and ragged right edges. When opened, the eight columns thus presented to the reader have much the same appearance as the succession of columns in a papyrus roll; the poetical books of the Old Testament are written stichometrically, in only two columns per page.
The codex has 4,000,000 uncial letters. The work was written in scriptio continua with neither polytonic accents. Occasional points and a few ligatures are used, though nomina sacra with overlines are employed throughout; some words abbreviated in other manuscripts, are in this codex written in both full and abbreviated forms. The following nomina sacra are written in abbreviated forms: ΘΣ ΚΣ ΙΣ ΧΣ ΠΝΑ ΠΝΙΚΟΣ ΥΣ ΑΝΟΣ ΟΥΟΣ ΔΑΔ ΙΛΗΜ ΙΣΡΛ ΜΗΡ ΠΗΡ ΣΩΡ. A plain iota is replaced by the epsilon-iota diphthong, e.g. ΔΑΥΕΙΔ instead οf ΔΑΥΙΔ, ΠΕΙΛΑΤΟΣ instead of ΠΙΛΑΤΟΣ, ΦΑΡΕΙΣΑΙΟΙ instead of ΦΑΡΙΣΑΙΟΙ, etc. Each rectangular page has the proportions 1.1 to 1, while the block of text has the reciprocal proportions, 0.91. If the gutters between the columns were removed, the text block would mirror the page's proportions. Typographer Robert Bringhurst referred to the codex as a "subtle piece of craftsmanship"; the folios are made of vellum parchment from calf skins, secondarily from sheep skins. Most of the quires or signatures contain four sheets, save two containing five.
It is estimated that the hides of about 360 animals were employed for making the folios of this codex. As for the cost of the material, time of scribes and binding, it equals the lifetime wages of one individual at the time; the portion of the codex held by the British Library consists of 346½ folios, 694 pages, constituting over half of the original work. Of these folios, 199 belong to the Old Testament, including the apocrypha, 147½ belong to the New Testament, along with two other books, the Epistle of Barnabas and part of The Shepherd of Hermas; the apocryphal books present in the surviving part of the Septuagint are 2 Esdras, Judith, 1 and 4 Maccabees and Sirach. The books of the New Testament are arranged in this order: the four Gospels, the epistles of Paul, the Acts of the Apostles, the General Epistles, the Book of Revelation; the fact that some parts of the codex are preserved in good condition while others are in poor condition implies they were separated and stored in several places.
The text of the Old Testament contains the following passages: Genesis 23:19 – Genesis 24:46 – fragments Leviticus 20:27 – Leviticus 22:30 Numbers 5:26–Numbers 7:20 – fragments 1 Chronicles 9:27–1 Chronicles 19:17 Ezra–Nehemiah. Book of Psalms–Wisdom of Sirach Book of Esther Book of Tobit Book of Judith Book of Joel–Book of Malachi Book of Isaiah Book of Jeremiah Book of Lamentations 1 Maccabees–4 Maccabees The text of the New Testament lacks several passages: Omitted verses Gospel of Matthew 12:47, 16:2b-3, 17:21, 18:11, 23:14, 24:35.
Frank Lauren Hitchcock was an American mathematician and physicist known for his formulation of the transportation problem in 1941. Frank did his preparatory study at Phillips Andover Academy, he entered Harvard University and completed his bachelor's degree in 1896. He began teaching, first in Paris and at Kenyon College in Gambier, Ohio. From 1904 to 1906 he taught chemistry at Fargo. Hitchcock returned to Massachusetts and began to teach at Massachusetts Institute of Technology and study at the graduate level at Harvard. In 1910 he obtained a Ph. D. with a thesis entitled, Vector Functions of a Point. Hitchcock stayed at MIT until retirement, publishing his analysis of optimal distribution in 1941. Frank Hitchcock was descended from New England forebears, his mother was Susan Ida Porter and his father was Elisha Pike Hitchcock. His parents married on June 27, 1866. Frank was born March 1875, in New York City, he had two sisters, Mary E. Hitchcock and Viola M. Hitchcock, two brothers, George P. Hitchcock and Ernest Van Ness Hitchcock.
Although Frank was born in New York City, he was raised in Vermont. Frank married Margaret Johnson Blakely in Paris, France on May 25, 1899, they had three children, Lauren Blakely, John Edward, George Blakely, January 12, 1910. At the time of his death Frank had 6 great-grandsons. 1910: Vector Functions of a Point. 1915: A Classification of Quadratic Vectors Functions, Proceedings of the National Academy of Sciences of the United States of America 1:177 to 183. 1917: On the simultaneous formulation of two linear vector functions, Proceedings of the Royal Irish Academy Section A 34: 1 to 10. 1920: A study of the vector product Vφαθβ, Proceedings of the Royal Irish Academy Section A 35: 30 to 7. 1920: A Thermodynamic Study of Electrolytic Solutions, Proceedings of the National Academy of Sciences of the United States of America 6:186 to 197. 1920: An Identical Relation Connecting Seven Vectors. 1921: The Axes of a Quadratic Vector, Proceedings AAAS 56:331 to 351. 1921: with Norbert Wiener, A New Vector Method in Integral Equations, MIT Journal of Mathematics and Physics volume 1.
1923: On Double Polyadics, with Application to the Linear Matrix Equation, Proceedings AAAS 58: 355 to 395. 1923: Identities Satisfied by Algebraic Point Functions in N-space, Proceedings AAAS 58: 399 to 421. 1923: with Clark S. Robinson, Differential Equations in Applied Chemistry, John Wiley & Sons, now from Archive.org. 1923: A Method for the Numerical Solution of Integral Equations. 1924: The Coincident Points of Two Algebraic Transformations. 1922: A Solution of the Linear Matrix Equation by Double Multiplication. Dr. Frank L. Hitchcock, Professor Emeritus at M. I. T. Dies at 82, The New York Times, June 1, 1957, p. 17. Frank L. Hitchcock "The distribution of a product from several sources to numerous localities", MIT Journal of Mathematics and Physics 20:224–230 MR0004469. D. R. Fulkerson Hitchcock Transportation Problem, RAND corporation. Frank Lauren Hitchcock at the Mathematics Genealogy Project Hitchcock's family tree Obituary
Coon Rapids is a city in Carroll and Guthrie counties in the U. S. state of Iowa. The population was 1,305 at the 2010 census unchanged from the 2000 census; the small portion of Coon Rapids that lies in Guthrie County is part of the Des Moines–West Des Moines Metropolitan Statistical Area. Wheeling and dealing in public land marked the emergence of Carroll county; the county seat, was built on land given by two Fort Des Moines speculators. Two savvy Carrollton residents, Crocket Ribble and Jacob Cretsinger decided to try their hand in real estate, they purchased land along the Middle Raccoon River, built a saw and grist mill and went into business in 1864. Between the impact of the Civil War and national panics, frontier settlement slowed down. However, the partners were able to establish a post office, named Coon Rapids. Returning civil war veterans, William Minnich and his brother in law, Michael Shettler saw potential in the hamlet. After purchasing land, they submitted a plat for the village of Coon Rapids and built what would become a store-hotel and home for the Shettler family.
Minnich maintained his farm in adjoining Guthrie County. Between 1870 and 1880, the hamlet grew as former farmers became merchants and tradesmen and newcomers came to the area. In addition to the Mill, the town had several general stores offering an array of goods, a hardware store, implement dealer and the all important real estate agent; when the Chicago, St Paul and Milwaukee started to build a rail line about a half mile south west of the hamlet, they established a rough and tumble camp for their workers, many of whom were accompanied by their families. The railroad project provided good money for local boys and newcomers. A boom began. Between 1880 and 1886, merchants in the village of coon rapids moved their buildings into what the railroad had platted as a town. Main street became lined with business houses and homes and the area between the old and new towns was transformed into a residential area; the editor of the newly established newspaper, Coon Rapids Enterprise, bemoaned the lawlessness and intemperate behavior found in the new town.
Selling liquor seemed to be the primary business! However, the town grew, nearly doubling in population and the new commercial center by the railroad expanded with a variety of new and old businesses. 1886 could have marked the end of Coon Rapids. A tornado ripped across western Iowa and Coon Rapids was in its path; the eastern part of town was demolished. Only two in town had died, but the property damage within town and along the tornadoes route was immense. Help poured in from around the United States and the town rebuilt. However, this wooden frontier community was vulnerable to fire. Between 1887 and 1894, a multitude of fires occurred some caused by arson, others by lightning, others the result of cinders from flues igniting dry, shingled roofs. During the late 19th century, Coon Rapids developed a modern, fireproof commercial district made up of brick buildings, exhibiting a variety of Victorian facades. Now this small brick city began to the amenities of urban life such as theater productions, roller skating, billiards, restaurants and a variety of shops and services, dray lines and livery barns.
There were wooden sidewalks and street lights. A night watch and sheriff kept night time lawlessness in control and limited racing down Main street. Now there were community celebrations such as July 4 and Decoration Day for both town and rural folk. A town baseball team was another attraction; the town became a service center for a growing agricultural economy. Community wide events such as Decoration Day, Fourth of July celebration, school graduations. Church and club celebrations became part of community life and served to integrate community and countryside. In response to the increased town and rural population and agricultural specialization, Coon Rapids saw the appearance of service industries to support the changing farm economy. There were carpenters specializing in farm building construction, well diggers and drainage concerns, dealers in cement and other types of fencing, a creamery to support the burgeoning dairy and poultry industry. By the early twentieth century, Coon Rapids was the dominant trading center between Perry and Manning.
The downtown was filled with two and three storey brick buildings and offered an array of shops and amenities such as an opera house, bowling alley, restaurants, a hotel and other amusements. From a simple market and trading point, Coon Rapids had become the economic, social and service center for the four county areas, it continued in this role despite the fall in farm values in the late teens and Great Depression of the 1930s. The entrepreneurial tradition that marks Coon Rapids was expressed in the twentieth century by businesses that served the diverse agricultural economy of the area; these included major grain dealers who maintained elevators in town, lumber men, implement dealers, a creamery and related produce stations, extensive poultry operations, a stock yard and sale barn. Of particular important to the town's 20th century life was the emergence of the hybrid corn business. Industrial agriculture transformed the Midwest in the post WW II era. Economies of scale shifted centers of production, for example, the poultry business became concentrated in the southeastern United States, the size of farms increased, corporate rather than individual farming operations became the norm.
For Coon Rapids this had varied impacts. Garst and Thomas Seed had expanded into an international concern by the mid-1950s offering local employment opportunities. Garst and Thomas expanded physically taking over many of the downtown buildings in Coon Rapids, co
Marvin X is a poet and essayist. Born Marvin Ellis Jackmon in Fowler, California, he has taken the Muslim name El Muhajir, his work has been associated with the Black Arts/Black Aesthetics Movement of the 1960s. He grew up in an activist household, he graduated from Thomas Alva Edison High School in Fresno in 1962. His parents published the Black-owned paper of Fresno, called the Fresno Voice; the 1947 paper advertised community events, local businesses, including their own real-estate business, focused on national and state events including: the promotion of anti-lynching laws, Jackie Robinson Day, New York Freedom trains being integrated, the mission work of the Catholic church with Indian and Negroes, the $350 million expansion of PG&E in California. Marvin X has one son who preceded him in death; because of X's affiliations with Black Panther activists of the day and his work in Black theater with Ed Bullins, X is considered one of the major essayists and playwrights of the Black Aesthetics Movement.
He attended Merritt College, where he met Huey P. Newton and Bobby Seale, received his BA and MA in English from San Francisco State University. X has taught at San Francisco State University, Fresno State University, UC Berkeley, UC San Diego, Mills College, Merritt College, Laney College, the University of Nevada at Reno and Reedley Community College, he has lectured at colleges and universities, including the University of Arkansas, the University of Houston and Spelman Colleges, the University of Virginia, Howard University, the University of Pennsylvania, Temple University, Fresno City College, Medgar Evers College in Brooklyn, NYU, UMass Boston. X attended Oakland City College, where he was introduced to Black nationalism and became friends with future Black Panther founders Huey P. Newton and Bobby Seale. X earned a B. A. and M. A. in English from San Francisco State University and emerged as an important voice in the Black Arts Movement, the artistic arm of the Black Power movement, in the mid-to-late 1960s.
He wrote for many of the BAM's key journals. He co-founded, with playwright Ed Bullins and others, two of BAM's premier West Coast headquarters and venues — Oakland's Black House and San Francisco's Black Arts/West Theatre. In 1967, X became known as El Muhajir. In the 1980s, he organized the Melvin Black Forum on Human Rights and the first Annual All Black Men's Conference, he served as an aide to former Black Panther Eldridge Cleaver and created the short-lived Marvin X Center for the Study of World Religions. In 1999, he founded San Francisco's Recovery Theatre, his production of One Day in the Life, the play he wrote about his drug addiction and recovery, became the longest-running African-American drama in Northern California. In 2004, in celebration of Black History Month, he produced the San Francisco Tenderloin Book Fair and University of Poetry, he has taught Black Studies, creative writing, journalism and Arabic at a variety of California universities and colleges. One of the movers and shakers of the Black Arts Movement, Marvin X has published 30 books, including essays, plays and his autobiography, Somethin’ Proper.
Notable books include Fly to Allah, Beyond Religion, Toward Spirituality, How to Recover from the Addiction to White Supremacy. In 2011, UC Berkeley Bancroft Library acquired the Marvin X papers, he continues to work as an activist, educator and producer. PEN Oakland, Reginald Lockett Lifetime Achievement Award, 2015 Marvin X Day proclaimed by the City and County of San Francisco, 2001 Life Member, California Scholarship Federation, Honor Society National Endowment for the Arts Writing Fellowship, 1972 National Endowment for the Humanities Planning Grants, 1979 Black Bird Press News & Review
Glenn McLeay is a cyclist from New Zealand. At the 1990 Commonwealth Games at Auckland he won a gold medal in the 4000m team pursuit, came 9th in the 10 mile track pursuit. At the 1992 Summer Olympics at Barcelona he came 4th in the points race and 7th in the 4000m team pursuit. At the 1994 Commonwealth Games he won a silver medal in the 10 mile race, came 4th in the 4000m team pursuit, came 4th in the points race. At the 1996 Summer Olympics at Atlanta he came 9th in the points race. Black Gold by Ron Palenski p. 63 ISBN 047600683X Glenn McLeay at the New Zealand Olympic Committee Evans, Hilary. "Glenn McLeay". Olympics at Sports-Reference.com. Sports Reference LLC. Archived from the original on 13 December 2012
Linear Amplification via Transposon Insertion is a linear whole genome amplification method. To analyze or sequence small amount of DNA, i.e. genomic DNA from a single cell, the picograms of DNA is subject to WGA to amplify at least thousands of times into nanogram scale, before DNA analysis or sequencing can be carried out. Previous WGA methods use exponential/nonlinear amplification schemes, leading to bias accumulation and error propagation. LIANTI achieved linear amplification of the whole genome for the first time, enabling more uniform and accurate amplification. Shown in the figure is a simulation to illustrate the advantages of linear amplification over exponential amplification, assuming two DNA fragments A and B with replication yields of 100% and 70% per round, respectively. First, linear amplification is more than exponential amplification. To achieve ~10,000 fold amplification of fragment A, exponential amplification results in a ratio of 8:1, hampering the accuracy of CNV detection.
In contrast, linear amplification exhibits a ratio of 1:0.7, much closer to unity. Second, linear amplification is superior to exponential amplification in fidelity. In exponential amplification, errors generated in early cycles of amplification will be propagated permanently, leading to SNV false-positives. In contrast, in linear amplification, the errors would appear randomly at different locations in the amplicons to be filtered out. Genomic DNA is randomly fragmented and tagged by Tn5 transposon insertion containing T7 promoter sequence, the resulting DNA fragments are linearly amplified into RNAs by T7 in vitro transcription. Following reverse transcription and second strand synthesis, double-stranded DNA amplicons are formed representing the linear amplification product of the original genomic DNA, suitable for DNA library preparation and sequencing. 1. Cell lysis. Single cells are placed into PCR tubes containing lysis buffer by mouth pipetting, flow sorting, laser dissection or microfluidic devices.
Cells are subsequently lysed by Qiagen protease digestion. If the starting material is small amount of genomic DNA instead of single cells, cell lysis step can be skipped. 2. LIANTI transposome. LIANTI transposome is made by mixing equal molar of Tn5 transposase and LIANTI transposon DNA; the sequence of LIANTI transposon DNA is: 5'/Phos/CTGTCTCTTATACACATCTGAACAGAATTTAATACGACTCACTATAGGGAGATGTGTATAAGAGACAG-3' After self annealing, the LIANTI transposon DNA consists of a 19-bp double-stranded region for Tn5 transposase binding and dimerization, a 30-nt single-stranded loop containing T7 promoter sequence. 3. Tn5 transposition. Genomic DNA from a single cell is randomly fragmented and tagged by LIANTI transposome insertion during transposition reaction. 4. Gap filling. After Tn5 transposition, both ends of each DNA fragment are gap filled and extended by DNA polymerase extension, converting single-stranded loops into double-stranded T7 promoters on both ends of each fragment; the residue Tn5 transposase and DNA polymerase are subsequently removed by protease digestion, followed by heat inactivation of the protease.
5. In vitro transcription linear amplification. Still within the same PCR tube, overnight IVT reaction is assembled, including standard IVT buffer, NTPs, T7 RNA polymerase, RNase inhibitor, DMSO, etc. 6. Reverse transcription. After overnight IVT, RNAs representing the linearly amplified products of the original genomic DNA are column purified, self primed on the 3′ end, reverse transcribed. RNase digestion is carried out to convert the double-stranded DNA-RNA hybrids into single-stranded DNA. 7. Second strand synthesis. Taking advantage of the 19-bp specific sequence on the 3' end of each single-stranded DNA, SSS step is performed by specific priming and DNA polymerase extension; the resulting double-stranded DNA fragments are LIANTI amplicons linearly amplified from the original single-cell genomic DNA, with unique molecular barcodes attached on each amplicon. 8. Library sequencing. Depending on transposome insertion density and specific applications, LIANTI amplicons can be subject to optional sonication, before proceeding to standard library prep pipelines.
LIANTI exhibits the highest amplification uniformity compared to other single-cell WGA methods, as shown by read depth plots across the genome, as well as coefficient of variation for read depths along the genome as a function of bin size. Together with its unique capability of digital counting to infer fragment numbers based on the mapping coordinates of each amplicon, LIANTI allows accurate detection of single-cell micro-CNVs with kilobase resolution. For comparison, other single-cell WGA methods including DOP-PCR, MDA and MALBAC can only detect CNVs with megabase resolution due to amplification noise, thus missing micro-CNVs in single cells. By virtue of linear amplification, LIANTI achieves the highest amplification fidelity for single-cell single-nucleotide variation detection with the low fidelity of T7 RNA polymerase. However, the SNV false positive rate of LIANTI is dominated by C-to-T false positives associated with the experimental artifact of cytosine deamination into uracil upon cell lysis.
This was evidenced by the SNV false positive spectra of LIANTI and MDA, which are different from that of the bulk. Moreover, uracil-DNA glycosylase treatment before IVT linear amplification can eliminate C-to-T false positives by removing uracil generated upon cell lysis. With UDG treatment, LIANTI has a false positive rate of 1.7 × 10−6 under a particular experimental condition for single BJ cells. LIANTI achieves a high genome coverage between 90% and 98%, as well as a low allele dropout ra